This is a working overview of CJC-1295, written for readers who want more than a one-paragraph summary but less than a textbook.
This page was last updated on 2025-10-02 and is reviewed periodically as new material appears.
The dividing feature between the two forms is a maleimide-based drug affinity complex, abbreviated DAC. In the DAC-bearing version, a linker attaches the peptide to serum albumin after administration, and that association slows removal from plasma. The version lacking DAC appears in catalogs as MOD GRF(1-29) or tetrasubstituted GRF(1-29). Because informal writing treats both as one item, comparisons drawn from such sources routinely blend measurements taken from two molecules with substantially different behavior.
Four amino acid substitutions separate the modified backbone from the parent GRF(1-29) sequence. These changes reduce recognition by dipeptidyl peptidase IV and related proteases, extending the interval before degradation. Development work in this area sought longer-acting GHRH analogs for endocrine investigation. Published descriptions treat the substitution set as a defining property of the core sequence, while the albumin-binding linker is described separately as an optional addition to that same backbone.
Pharmacokinetic behaviour differs sharply between the two forms. The DAC-bearing peptide shows an extended circulation time measured in days, whereas the version without the complex is cleared within roughly half an hour. This gap shapes how researchers design dosing schedules in animal models. Whether the prolonged presence of the DAC form produces effects meaningfully different from the short-acting variant remains an open question, since comparative human data are scarce.
CJC-1295 is a synthetic peptide designed to mimic growth hormone-releasing hormone (GHRH), the endogenous signal that prompts the pituitary gland to release growth hormone. The compound is a modified fragment of the natural hormone, spanning the first twenty-nine amino acids of GHRH with several substitutions that slow enzymatic breakdown. Two variants circulate in research settings: one carrying a drug affinity complex (DAC) and one without it. The DAC-free form is frequently labelled Mod GRF(1-29) in catalogs and discussion forums.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Synthetic peptide | Analog of growth hormone-releasing hormone |
| Chain length | 29 amino acids | Based on the GRF(1-29) fragment |
| Appearance | White to off-white lyophilized powder | Common research supply form |
| Solubility | Soluble in water and aqueous buffers | Powder requires reconstitution before use |
| Typical storage | −20 °C or below | Kept away from light and moisture |
Molecular pathology is focused upon the study and diagnosis of disease through the examination of molecules within organs, tissues or bodily fluids. Molecular pathology is multidisciplinary by nature and shares some aspects of practice with both anatomic pathology and clinical pathology, molecular biology, biochemistry, proteomics and genetics. It is often applied in a context that is as much scientific as directly medical and encompasses the development of molecular and genetic approaches to the diagnosis and classification of human diseases, the design and validation of predictive biomarkers for treatment response and disease progression, and the susceptibility of individuals of different genetic constitution to particular disorders. The crossover between molecular pathology and epidemiology is represented by a related field "molecular pathological epidemiology". Molecular pathology is commonly used in diagnosis of cancer and infectious diseases. Molecular Pathology is primarily used to detect cancers such as melanoma, brainstem glioma, brain tumors as well as many other types of cancer and infectious diseases. Techniques are numerous but include quantitative polymerase chain reaction (qPCR), multiplex PCR, DNA microarray, in situ hybridization, DNA sequencing, antibody-based immunofluorescence tissue assays, molecular profiling of pathogens, and analysis of bacterial genes for antimicrobial resistance. Techniques used are based on analyzing samples of DNA and RNA. Pathology is widely used for gene therapy and disease diagnosis.
The explosive trace detectors utilizing AFPs, known as Fido Explosives Detectors, were originally developed under the Defense Advanced Research Projects Agency (DARPA) Dog’s Nose program and is now produced by FLIR Systems. The current generation, provides broad-band trace explosive detection and weighs less than 3 lbs. The sensitivity is in the order of femtogram (1 × 10−15 grams). This is the only such technology in the field that can achieve such sensitivity.
=== Mechanism of action === Elbasvir targets the NS5A protein, which effectively prevents the transcription of the HCV RNA and also prevents virion assembly. "Median EC50 values range from 0.2 to 3600 pmol/L, based on genotype." Grazoprevir is an protease inhibitor targeting HCV NS3/4A serine protease. Effectively grazoprevir prevents cleavage of the necessary polyproteins for replication.
A blue check is used on social media platforms, notably X (formerly known as Twitter), to indicate the authenticity of an account. Since November 2022, Twitter users whose accounts are at least 90 days old and have a verified phone number receive verification upon subscribing to X Premium or Verified Organizations; this status persists as long as the subscription remains active. When introduced in June 2009, the system provided the site's readers with a means to distinguish genuine notable account holders, such as celebrities and organizations, from impostors or parodies. Until November 2022, a blue checkmark displayed against an account name indicated that Twitter had taken steps to ensure that the account was actually owned by the person or organization whom it claimed to represent. The checkmark does not imply endorsement from Twitter, and does not mean that tweets from a verified account are necessarily accurate or truthful in any way. People with verified accounts on Twitter are often colloquially referred to as "blue checks" on social media and by reporters. In November 2022, the verification program was modified heavily by new owner Elon Musk, extending verification to any account with a verified phone number and an active subscription to an eligible X Premium (formerly Twitter Blue) plan. These changes faced criticism from users and the media, who believed that the changes would ease impersonation, and allow accounts spreading misleading information to feign credibility.
Layne Staley – lead and backing vocals, rhythm guitar on "Hate to Feel" and "Angry Chair"; sun logo/icons Jerry Cantrell – guitars, backing vocals, co-lead vocals on "Down in a Hole" and "Would?" Mike Starr – bass Sean Kinney – drums Additional personnel
Sources: en.wikipedia.org
== Further reading == Biot, René. (1962). The Enigma of the Stigmata. Hawthorn Books. Carroll, Robert Todd. (2003). Stigmata. In The Skeptic's Dictionary. Wiley. ISBN 978-0-471-27242-7 Harrison, Ted. (1994). Stigmata: A Medieval Phenomenon in a Modern Age. St Martins Press. ISBN 0-312-11372-2 Mazzoni, Cristina. (1996). Saint Hysteria: Neurosis, Mysticism, and Gender in European Culture. Cornell University Press. ISBN 0-8014-3229-4 Nickell, Joe. (1993). Looking for a Miracle: Weeping Icons, Relics, Stigmata, Visions & Healing Cures. Prometheus Books. ISBN 1-57392-680-9 Radford, Benjamin. (2014). What is Stigmata?. LiveScience. Retrieved 12 May 2016. Wilson, Ian. (1988). The Bleeding Mind: An Investigation into the Mysterious Phenomena of Stigmata. Weidenfeld & Nicolson. ISBN 0-297-79099-4 Yarom, Nitza. (1992). Body, Blood, and Sexuality: A Psychoanalytic Study of St. Francis' Stigmata and Their Historical Context. Peter Lang Publisher. Van Osselaer, Tina; Graus, Andrea; Rossi, Leonardo; Smeyers, Kristof (12 October 2020). The Devotion and Promotion of Stigmatics in Europe c. 1800–1950, between Saints and Celebrities (PDF). Numen Book Series-Studies in the History of Religions. Vol. 167. Leiden, Boston: Brill. p. 487. ISBN 978-90-04-43935-1. ISSN 0169-8834. LCCN 2020031449. Archived (PDF) from the original on September 9, 2021.
===== Chain of two decays ===== Now consider the case of a chain of two decays: one nuclide A decaying into another B by one process, then B decaying into another C by a second process, i.e. A → B → C. The previous equation cannot be applied to the decay chain, but can be generalized as follows. Since A decays into B, then B decays into C, the activity of A adds to the total number of B nuclides in the present sample, before those B nuclides decay and reduce the number of nuclides leading to the later sample. In other words, the number of second generation nuclei B increases as a result of the first generation nuclei decay of A, and decreases as a result of its own decay into the third generation nuclei C. The sum of these two terms gives the law for a decay chain for two nuclides:
== Effects == The spectrum of effects of hormone therapy in transfeminine people depend on the specific medications and dosages used. In any case, the main effects of hormone therapy in transfeminine people are feminization and demasculinization, and are as follows:
Owen Chadwick was born in Bromley in 1916. He was awarded the Order of Merit, was Vice Chancellor of University of Cambridge, Master of Selwyn Cambridge, Regius Professor of Modern History, Dixie Professor of Ecclesiastical History, Chancellor of University of Anglia, President of the British Academy, and was a Rugby Union International. Other writers from Bromley include Captain W.E. Johns (author of the Biggles adventures), David Nobbs (author of The Fall and Rise of Reginald Perrin and writer for Les Dawson and The Two Ronnies), and Enid Blyton who wrote children's fiction. A blue historical plaque can be found on the external wall of her former home on Shortlands Road, Bromley. Other notable people who lived in Bromley include David Bowie; Jane Downs, (actress); Talbot Rothwell, (screenwriter of twenty Carry On films); actress Justine Lord; Peter Howitt; Richmal Crompton; Pixie Lott; Matt Terry; Christopher Tennant; Hanif Kureishi; Peter Frampton; Aleister Crowley; Fatboy Slim; Jack Dee; Tom Allen; D. Bernard Amos; Rob Beckett; actor Alexander Molony; Gary Rhodes; Pete Sears; singer Poly Styrene; Billy Idol; Brian Poole (of The Tremoloes); Billy Jenkins; Alex Clare; cricketer Jill Cruwys; the anarchist Peter Kropotkin; the former Clash drummer Topper Headon; illustrator Charles Keeping, children's writer Andrew Murray; tenor Roland Cunningham; actor Michael York, who attended Bromley Grammar School for Boys; and clarinetist Chris Craker. The musical conducting brothers Stephen and Nicholas Cleobury were born in Bromley, as was suffragette Marie du Sautoy Newby.
== Causes == Adverse drug reactions are classified as type A (intrinsic or pharmacological) or type B (idiosyncratic). Type A drug reaction accounts for 80% of all toxicities. Drugs or toxins that have a pharmacological (type A) hepatotoxicity are those that have predictable dose-response curves (higher concentrations cause more liver damage) and well characterized mechanisms of toxicity, such as directly damaging liver tissue or blocking a metabolic process. As in the case of paracetamol overdose, this type of injury occurs shortly after some threshold for toxicity is reached. Carbon tetrachloride is commonly used to induce acute type A liver injury in animal models. Idiosyncratic (type B) injury occurs without warning, when agents cause non-predictable hepatotoxicity in susceptible individuals, which is not related to dose and has a variable latency period. This type of injury does not have a clear dose-response nor temporal relationship, and most often does not have predictive models. Idiosyncratic hepatotoxicity has led to the withdrawal of several drugs from market even after rigorous clinical testing as part of the FDA approval process; Troglitazone (Rezulin) and trovafloxacin (Trovan) are two prime examples of idiosyncratic hepatotoxins pulled from market. The herb kava has caused a number of cases of idiosyncratic liver injury, ranging everywhere from asymptomatic to fatal.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
If the temperature is too low, the primer may bind imperfectly. If it is too high, the primer may not bind at all. A typical annealing temperature is about 3–5 °C below the Tm of the primers used. Stable hydrogen bonds between complementary bases are formed only when the primer sequence very closely matches the template sequence. During this step, the polymerase binds to the primer-template hybrid and begins DNA formation. Extension/Elongation: The temperature at this step depends on the DNA polymerase used; the optimum activity temperature for the thermostable DNA polymerase of Taq polymerase is approximately 75–80 °C (167–176 °F), though a temperature of 72 °C (162 °F) is commonly used with this enzyme. In this step, the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding free dNTPs from the reaction mixture that is complementary to the template in the 5'-to-3' direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxy group at the end of the nascent (elongating) DNA strand. The precise time required for elongation depends both on the DNA polymerase used and on the length of the DNA target region to amplify. As a rule of thumb, at their optimal temperature, most DNA polymerases polymerize a thousand bases per minute. Under optimal conditions (i.e., if there are no limitations due to limiting substrates or reagents), at each extension/elongation step, the number of DNA target sequences is doubled.
=== Food === Before being introduced into the aquarium trade, the dwarf, along with the snakeskin gourami was and still is a popular food fish in its native range. In Bangladesh it is known as "Kholisha" and "Khosti" in India and "Kungee" in Punjab as well as different linguistic variants within its range.
Electron-transfer dissociation (ETD) is a method of fragmenting multiply-charged gaseous macromolecules in a mass spectrometer between the stages of tandem mass spectrometry (MS/MS). Similar to electron-capture dissociation, ETD induces fragmentation of large, multiply-charged cations by transferring electrons to them. ETD is used extensively with polymers and biological molecules such as proteins and peptides for sequence analysis. Transferring an electron causes peptide backbone cleavage into c- and z-ions while leaving labile post translational modifications (PTM) intact. The technique only works well for higher charge state peptide or polymer ions (z>2). However, relative to collision-induced dissociation (CID), ETD is advantageous for the fragmentation of longer peptides or even entire proteins. This makes the technique important for top-down proteomics. The method was developed by Hunt and coworkers at the University of Virginia.
Sources: en.wikipedia.org
No. It is a laboratory-synthesized analog built on a fragment of the natural hormone. The natural peptide is shorter-lived and lacks the stabilizing substitutions found in the synthetic version.
DAC stands for drug affinity complex, a chemical group that binds the peptide to serum albumin. The binding slows clearance and lengthens the time the molecule stays in plasma compared with the unmodified analog.
Because two distinct molecules are discussed under one informal label. The albumin-binding version clears over several days, while the form without that group clears within roughly half an hour. Mixing results from both creates inconsistent figures.
The synthetic peptide keeps the receptor-binding region of GHRH but carries substitutions that resist enzymatic cleavage. In the DAC version, an added group also anchors the molecule to albumin, extending its presence in the bloodstream.